The Asylum   Search Private Messages Options Blogs Images Chat Cam Portals Calendar FAQ's Join  
Asylum Forums : Powered by vBulletin version 2.2.8 Asylum Forums > Images Of Desanctity > I don't actually LOVE this picture, but it's kind of cool.
Pages (201): « First ... « 192 193 194 195 196 197 198 199 200 [201]   Last Thread   Next Thread
Author
Thread [new thread]    [post reply]
DRZ
wank monkey

Registered: Jan 2011
Location:
Posts: 7750

Report this post to a moderator | IP: Logged

Old Post 05-19-2013 09:35 PM
DRZ is offline Click Here to See the Profile for DRZ Click here to Send DRZ a Private Message Find more posts by DRZ Add DRZ to your buddy list [P] Edit/Delete Message Reply w/Quote
creepy uncle
Disbarred proctologist

Registered: Apr 2006
Location: behind you
Posts: 13844

Eva Longoria shows Cannes her tampon string.

__________________
world's luckiest motherfuckers
Muffy $18.24 - Captain Doublestandards $14.17 - Pinecrika $12.19 - Vegas $10.36 - Magnolia $9.13 - avondale $8.87 - karen $7.98 - LF $7.24 - PNG $6.69 - Dingledongle $6.29 - Mr Freign $4.70 - Joeycat $4.67 - Ignatz mouse $4.22 - Skinny $3.94 - coincidence $3.75 - cw $3.64 - mudded $3.41 - T $3.06 - Mokkori $2.75 - fubar $2.06 - mmmtravis $2.00 - Trenchant_Troll $1.99 - SimpleSimon $1.96 - SocialParasite $1.73 - Azbat the 4th $1.32 – Goedile $1.26 - Billgerat $1.19 - Dacarlo $1.06 - MstrG $0.89 - Tray $0.65 - Mugtoe $0.64 - Loser $0.63 - SatansLeftHand $0.58 - Flocat $0.52 - Suki owes me $2976.49

Report this post to a moderator | IP: Logged

Old Post 05-23-2013 11:37 AM
creepy uncle is offline Click Here to See the Profile for creepy uncle Click here to Send creepy uncle a Private Message Find more posts by creepy uncle Add creepy uncle to your buddy list [P] Edit/Delete Message Reply w/Quote
gene genie
CTAGTCAACTGATCTACGCTGA

Registered: Oct 2008
Location: nw
Posts: 197

That's not a tampon. It's the rip-cord for her emergency fetal-ejection apparatus. It's the latest thing among starlets these days, especially those who marry pro athletes for a weekend or two. It's nice to snatch a glimpse (or vice versa) of her hairless snapper, though.

Report this post to a moderator | IP: Logged

Old Post 05-23-2013 03:23 PM
gene genie is offline Click Here to See the Profile for gene genie Click here to Send gene genie a Private Message Find more posts by gene genie Add gene genie to your buddy list [P] Edit/Delete Message Reply w/Quote
creepy uncle
Disbarred proctologist

Registered: Apr 2006
Location: behind you
Posts: 13844

Turns out we're both wrong. It's her recurrent thrush.

__________________
world's luckiest motherfuckers
Muffy $18.24 - Captain Doublestandards $14.17 - Pinecrika $12.19 - Vegas $10.36 - Magnolia $9.13 - avondale $8.87 - karen $7.98 - LF $7.24 - PNG $6.69 - Dingledongle $6.29 - Mr Freign $4.70 - Joeycat $4.67 - Ignatz mouse $4.22 - Skinny $3.94 - coincidence $3.75 - cw $3.64 - mudded $3.41 - T $3.06 - Mokkori $2.75 - fubar $2.06 - mmmtravis $2.00 - Trenchant_Troll $1.99 - SimpleSimon $1.96 - SocialParasite $1.73 - Azbat the 4th $1.32 – Goedile $1.26 - Billgerat $1.19 - Dacarlo $1.06 - MstrG $0.89 - Tray $0.65 - Mugtoe $0.64 - Loser $0.63 - SatansLeftHand $0.58 - Flocat $0.52 - Suki owes me $2976.49

Report this post to a moderator | IP: Logged

Old Post 05-23-2013 09:57 PM
creepy uncle is offline Click Here to See the Profile for creepy uncle Click here to Send creepy uncle a Private Message Find more posts by creepy uncle Add creepy uncle to your buddy list [P] Edit/Delete Message Reply w/Quote
creepy uncle
Disbarred proctologist

Registered: Apr 2006
Location: behind you
Posts: 13844

__________________
world's luckiest motherfuckers
Muffy $18.24 - Captain Doublestandards $14.17 - Pinecrika $12.19 - Vegas $10.36 - Magnolia $9.13 - avondale $8.87 - karen $7.98 - LF $7.24 - PNG $6.69 - Dingledongle $6.29 - Mr Freign $4.70 - Joeycat $4.67 - Ignatz mouse $4.22 - Skinny $3.94 - coincidence $3.75 - cw $3.64 - mudded $3.41 - T $3.06 - Mokkori $2.75 - fubar $2.06 - mmmtravis $2.00 - Trenchant_Troll $1.99 - SimpleSimon $1.96 - SocialParasite $1.73 - Azbat the 4th $1.32 – Goedile $1.26 - Billgerat $1.19 - Dacarlo $1.06 - MstrG $0.89 - Tray $0.65 - Mugtoe $0.64 - Loser $0.63 - SatansLeftHand $0.58 - Flocat $0.52 - Suki owes me $2976.49

Report this post to a moderator | IP: Logged

Old Post 05-23-2013 09:58 PM
creepy uncle is offline Click Here to See the Profile for creepy uncle Click here to Send creepy uncle a Private Message Find more posts by creepy uncle Add creepy uncle to your buddy list [P] Edit/Delete Message Reply w/Quote
creepy uncle
Disbarred proctologist

Registered: Apr 2006
Location: behind you
Posts: 13844

__________________
world's luckiest motherfuckers
Muffy $18.24 - Captain Doublestandards $14.17 - Pinecrika $12.19 - Vegas $10.36 - Magnolia $9.13 - avondale $8.87 - karen $7.98 - LF $7.24 - PNG $6.69 - Dingledongle $6.29 - Mr Freign $4.70 - Joeycat $4.67 - Ignatz mouse $4.22 - Skinny $3.94 - coincidence $3.75 - cw $3.64 - mudded $3.41 - T $3.06 - Mokkori $2.75 - fubar $2.06 - mmmtravis $2.00 - Trenchant_Troll $1.99 - SimpleSimon $1.96 - SocialParasite $1.73 - Azbat the 4th $1.32 – Goedile $1.26 - Billgerat $1.19 - Dacarlo $1.06 - MstrG $0.89 - Tray $0.65 - Mugtoe $0.64 - Loser $0.63 - SatansLeftHand $0.58 - Flocat $0.52 - Suki owes me $2976.49

Report this post to a moderator | IP: Logged

Old Post 05-25-2013 12:14 AM
creepy uncle is offline Click Here to See the Profile for creepy uncle Click here to Send creepy uncle a Private Message Find more posts by creepy uncle Add creepy uncle to your buddy list [P] Edit/Delete Message Reply w/Quote
creepy uncle
Disbarred proctologist

Registered: Apr 2006
Location: behind you
Posts: 13844

__________________
world's luckiest motherfuckers
Muffy $18.24 - Captain Doublestandards $14.17 - Pinecrika $12.19 - Vegas $10.36 - Magnolia $9.13 - avondale $8.87 - karen $7.98 - LF $7.24 - PNG $6.69 - Dingledongle $6.29 - Mr Freign $4.70 - Joeycat $4.67 - Ignatz mouse $4.22 - Skinny $3.94 - coincidence $3.75 - cw $3.64 - mudded $3.41 - T $3.06 - Mokkori $2.75 - fubar $2.06 - mmmtravis $2.00 - Trenchant_Troll $1.99 - SimpleSimon $1.96 - SocialParasite $1.73 - Azbat the 4th $1.32 – Goedile $1.26 - Billgerat $1.19 - Dacarlo $1.06 - MstrG $0.89 - Tray $0.65 - Mugtoe $0.64 - Loser $0.63 - SatansLeftHand $0.58 - Flocat $0.52 - Suki owes me $2976.49

Report this post to a moderator | IP: Logged

Old Post 05-25-2013 12:28 AM
creepy uncle is offline Click Here to See the Profile for creepy uncle Click here to Send creepy uncle a Private Message Find more posts by creepy uncle Add creepy uncle to your buddy list [P] Edit/Delete Message Reply w/Quote
creepy uncle
Disbarred proctologist

Registered: Apr 2006
Location: behind you
Posts: 13844

__________________
world's luckiest motherfuckers
Muffy $18.24 - Captain Doublestandards $14.17 - Pinecrika $12.19 - Vegas $10.36 - Magnolia $9.13 - avondale $8.87 - karen $7.98 - LF $7.24 - PNG $6.69 - Dingledongle $6.29 - Mr Freign $4.70 - Joeycat $4.67 - Ignatz mouse $4.22 - Skinny $3.94 - coincidence $3.75 - cw $3.64 - mudded $3.41 - T $3.06 - Mokkori $2.75 - fubar $2.06 - mmmtravis $2.00 - Trenchant_Troll $1.99 - SimpleSimon $1.96 - SocialParasite $1.73 - Azbat the 4th $1.32 – Goedile $1.26 - Billgerat $1.19 - Dacarlo $1.06 - MstrG $0.89 - Tray $0.65 - Mugtoe $0.64 - Loser $0.63 - SatansLeftHand $0.58 - Flocat $0.52 - Suki owes me $2976.49

Report this post to a moderator | IP: Logged

Old Post 05-25-2013 01:14 AM
creepy uncle is offline Click Here to See the Profile for creepy uncle Click here to Send creepy uncle a Private Message Find more posts by creepy uncle Add creepy uncle to your buddy list [P] Edit/Delete Message Reply w/Quote
Roshigoth
The Cheesemeister

Registered: Aug 2000
Location: Myrtle Beach, SC
Posts: 16222

__________________

Report this post to a moderator | IP: Logged

Old Post 05-25-2013 09:01 PM
Roshigoth is offline Click Here to See the Profile for Roshigoth Click here to Send Roshigoth a Private Message Find more posts by Roshigoth Add Roshigoth to your buddy list [P] Edit/Delete Message Reply w/Quote
DRZ
wank monkey

Registered: Jan 2011
Location:
Posts: 7750

Report this post to a moderator | IP: Logged

Old Post 05-25-2013 10:54 PM
DRZ is offline Click Here to See the Profile for DRZ Click here to Send DRZ a Private Message Find more posts by DRZ Add DRZ to your buddy list [P] Edit/Delete Message Reply w/Quote
All times are GMT. The time now is 10:59 PM. Post New Thread    Post A Reply
Pages (201): « First ... « 192 193 194 195 196 197 198 199 200 [201]   Last Thread   Next Thread
Show Printable Version | Email this Page | Subscribe to this Thread

Forum Jump:
Rate This Thread:

Forum Rules:
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts 		HTML code is ON
vB code is ON
Smilies are ON
[IMG] code is ON
 

< Contact Us - The Asylum >

Powered by: vBulletin Version 3.0.6
Copyright ©2000 - 2002, Jelsoft Enterprises Limited.
Copyright © 2000- Imaginet Inc.
[Legal Notice] | [Privacy Policy] | [Site Index]

Forums Directory