The Asylum   Search Private Messages Options Blogs Images Chat Cam Portals Calendar FAQ's Join  
Asylum Forums : Powered by vBulletin version 2.2.8 Asylum Forums > The Lost Forum > The Maury Povitch Show
  Last Thread   Next Thread
Author
Thread [new thread]    [post reply]
Large Filipino
Fuck me hard in my arse.

Registered: Feb 2004
Location: in colorado somewhere!
Posts: 47606
The Maury Povitch Show

I think this show pretty much summarizes the direction we as Americans are heading.
It used to be that our values wouldn't even dare have a show like this.
But today the phones are ringing off the hook so an innocent young princess can get on tv to proclaim her little prince of a child needs child support from his father.
And she's a thousand percent sure he's the father because she loves no other.
Thousand percent sure. There's no such thing as a thousand percent anything.
And then the commercials run.
And then the results are in.
And we are waiting for that one word.
That one word that says
That this young innocent princess is really a hoochie mama whore.
And we enjoy this.
At least the Steve Wilcos show has a sense of integrity with them. If you watch that show Steve is all ready to help his guest as long as they act like adults.
And the Jerry Springer show is what it is. A guy show with fights and titties.
But the Maury show makes it seem almost cool to be whores. Men and women alike.
That is all.

__________________

I want a Chia Obama
For Christmas

Report this post to a moderator | IP: Logged

Old Post 06-16-2013 11:47 PM
Large Filipino is offline Click Here to See the Profile for Large Filipino Click here to Send Large Filipino a Private Message Visit Large Filipino's homepage! Find more posts by Large Filipino Add Large Filipino to your buddy list [P] Edit/Delete Message Reply w/Quote
SimpleSimon
Forum God

Registered: Dec 2002
Location:
Posts: 26347

That simple fact that you watch such drivel and try to 'discuss' it says that you have nothing to say worth hearing.

__________________
He's (Obama) the President of Hate. He has magically allowed the blue monkeys to embrace hatred, to feel proud of it, to murder, to conquer. They never would have been able to take this step without him.
**Freign**

Report this post to a moderator | IP: Logged

Old Post 06-17-2013 12:38 AM
SimpleSimon is offline Click Here to See the Profile for SimpleSimon Click here to Send SimpleSimon a Private Message Find more posts by SimpleSimon Add SimpleSimon to your buddy list [P] Edit/Delete Message Reply w/Quote
Krunk Fu
Nuke the Whales

Registered: Dec 2012
Location:
Posts: 1214

You shouldn't watch those shows, they kill brain cells.

Report this post to a moderator | IP: Logged

Old Post 06-17-2013 12:48 AM
Krunk Fu is offline Click Here to See the Profile for Krunk Fu Click here to Send Krunk Fu a Private Message Find more posts by Krunk Fu Add Krunk Fu to your buddy list [P] Edit/Delete Message Reply w/Quote
Large Filipino
Fuck me hard in my arse.

Registered: Feb 2004
Location: in colorado somewhere!
Posts: 47606

But I'm at home during this time.
And the commercials are filled with private colleges telling me what the fuck I'm supposed to do with my life.
That's another American Fail.
Companies that call themselves College with their fine print that say their courses are not college credits and they don't guarantee you a job.

I think I'm just soul searching today.
I'm staring at a pic when I was of high school grade and I'm thinking I was quite skinny back then because i rode my bike all the time. I didn't have a cell phone never mind a smart phone,a walkman cassette player was what you needed to have and the internets was just a dream.
And when you think even further back although men brag about who they shagged they were not proud in the least when it produced a child and he has no involvement. You were looked down on. Yes that still happens today but people don't seem to care all that much.
And women were definitely not going on tv trying to find the father of their child.
But today it's like "fuck it".
What happened with all that?

__________________

I want a Chia Obama
For Christmas

Last edited by Large Filipino on 06-17-2013 at 03:04 AM

Report this post to a moderator | IP: Logged

Old Post 06-17-2013 02:57 AM
Large Filipino is offline Click Here to See the Profile for Large Filipino Click here to Send Large Filipino a Private Message Visit Large Filipino's homepage! Find more posts by Large Filipino Add Large Filipino to your buddy list [P] Edit/Delete Message Reply w/Quote
Krunk Fu
Nuke the Whales

Registered: Dec 2012
Location:
Posts: 1214

Ohhh the lovely "online college degree" pathetic if you ask me.

Report this post to a moderator | IP: Logged

Old Post 06-17-2013 03:07 AM
Krunk Fu is offline Click Here to See the Profile for Krunk Fu Click here to Send Krunk Fu a Private Message Find more posts by Krunk Fu Add Krunk Fu to your buddy list [P] Edit/Delete Message Reply w/Quote
Large Filipino
Fuck me hard in my arse.

Registered: Feb 2004
Location: in colorado somewhere!
Posts: 47606

I don't get why people fall for it.

__________________

I want a Chia Obama
For Christmas

Report this post to a moderator | IP: Logged

Old Post 06-17-2013 03:09 AM
Large Filipino is offline Click Here to See the Profile for Large Filipino Click here to Send Large Filipino a Private Message Visit Large Filipino's homepage! Find more posts by Large Filipino Add Large Filipino to your buddy list [P] Edit/Delete Message Reply w/Quote
Krunk Fu
Nuke the Whales

Registered: Dec 2012
Location:
Posts: 1214

I know a woman who got her "university of Phoenix" degree and she goes around bragging about it as if she actually earned a degree. Pffft! Try actually going to college lady, it aint easy.

Report this post to a moderator | IP: Logged

Old Post 06-17-2013 03:11 AM
Krunk Fu is offline Click Here to See the Profile for Krunk Fu Click here to Send Krunk Fu a Private Message Find more posts by Krunk Fu Add Krunk Fu to your buddy list [P] Edit/Delete Message Reply w/Quote
Large Filipino
Fuck me hard in my arse.

Registered: Feb 2004
Location: in colorado somewhere!
Posts: 47606

You do better with an associates degree in a community college. Because a degree under any subject is still a degree which puts you at a higher pay backet at any occupation.

__________________

I want a Chia Obama
For Christmas

Report this post to a moderator | IP: Logged

Old Post 06-17-2013 03:20 AM
Large Filipino is offline Click Here to See the Profile for Large Filipino Click here to Send Large Filipino a Private Message Visit Large Filipino's homepage! Find more posts by Large Filipino Add Large Filipino to your buddy list [P] Edit/Delete Message Reply w/Quote
Dacarlo
Mr Sayang

Registered: Oct 2000
Location: UK
Posts: 13964

Simply knowing shit makes you more employable.

__________________
quote:
Originally posted by Large Filipino
I'm really a babe with a tight ass looking for a large internet cock.

Report this post to a moderator | IP: Logged

Old Post 06-17-2013 03:22 AM
Dacarlo is offline Click Here to See the Profile for Dacarlo Click here to Send Dacarlo a Private Message Find more posts by Dacarlo Add Dacarlo to your buddy list [P] Edit/Delete Message Reply w/Quote
Large Filipino
Fuck me hard in my arse.

Registered: Feb 2004
Location: in colorado somewhere!
Posts: 47606

Here you have to be in good health.

__________________

I want a Chia Obama
For Christmas

Report this post to a moderator | IP: Logged

Old Post 06-17-2013 05:07 AM
Large Filipino is offline Click Here to See the Profile for Large Filipino Click here to Send Large Filipino a Private Message Visit Large Filipino's homepage! Find more posts by Large Filipino Add Large Filipino to your buddy list [P] Edit/Delete Message Reply w/Quote
bacidath
me - a killer

Registered: Jul 2000
Location: Spazchair
Posts: 6861
Re: The Maury Povitch Show

quote:
Originally posted by Large Filipino
I think this show pretty much summarizes the direction we as Americans are heading.


it took you 22 years of a show being on to realize that america was going down the tubes....( what tubes... have you seen any tubes) 2:35

__________________
Refers to the part consisting of leather horse ass never seen a dense fibrous tissue.

Report this post to a moderator | IP: Logged

Old Post 06-17-2013 06:51 AM
bacidath is offline Click Here to See the Profile for bacidath Click here to Send bacidath a Private Message Find more posts by bacidath Add bacidath to your buddy list [P] Edit/Delete Message Reply w/Quote
Pinecrika
Muffer's He-beast

Registered: Jul 2001
Location: Aotearoa
Posts: 19350

Did someone say tubes?

__________________
"I just like holding it, sometimes I pop it in my mouth and give it a little suck, but not often." - DRZ

Report this post to a moderator | IP: Logged

Old Post 06-17-2013 08:37 AM
Pinecrika is offline Click Here to See the Profile for Pinecrika Click here to Send Pinecrika a Private Message Find more posts by Pinecrika Add Pinecrika to your buddy list [P] Edit/Delete Message Reply w/Quote
billgerat
Hope-nosis

Registered: Aug 2000
Location: ObamaNation
Posts: 25210

Tubes?



__________________
"I'm not a firm believer in democracy," - Rand Paul -

Report this post to a moderator | IP: Logged

Old Post 06-17-2013 08:53 AM
billgerat is offline Click Here to See the Profile for billgerat Click here to Send billgerat a Private Message Find more posts by billgerat Add billgerat to your buddy list [P] Edit/Delete Message Reply w/Quote
Large Filipino
Fuck me hard in my arse.

Registered: Feb 2004
Location: in colorado somewhere!
Posts: 47606

This is now the riding into tubes thread.

__________________

I want a Chia Obama
For Christmas

Report this post to a moderator | IP: Logged

Old Post 06-17-2013 05:58 PM
Large Filipino is offline Click Here to See the Profile for Large Filipino Click here to Send Large Filipino a Private Message Visit Large Filipino's homepage! Find more posts by Large Filipino Add Large Filipino to your buddy list [P] Edit/Delete Message Reply w/Quote
gene genie
CTAGTCAACTGATCTACGCTGA

Registered: Oct 2008
Location: nw
Posts: 249

I didn't know Maury was still on the air. Not that I'd watch it anyway. If it's any consolation, he can fuck Connie Chung anytime he wants to (and you know what they say about Asian women).

The female version of Popeye's pal Wimpy:


"I will gladly fuck you Tuesday, for a cheeseburger today (or stab you, take your pick)."

Report this post to a moderator | IP: Logged

Old Post 06-17-2013 07:37 PM
gene genie is offline Click Here to See the Profile for gene genie Click here to Send gene genie a Private Message Find more posts by gene genie Add gene genie to your buddy list [P] Edit/Delete Message Reply w/Quote
Trenchant_Troll
ad hominid

Registered: Mar 2004
Location: USA
Posts: 42370

quote:
Originally posted by Krunk Fu
You shouldn't watch those shows, they kill brain cells.


Look who started this thread, then read aloud what you just wrote there.

__________________
When governments fear the people, there is liberty. When the people fear the government, there is tyranny. ~ Thomas Jefferson

Report this post to a moderator | IP: Logged

Old Post 06-18-2013 06:45 PM
Trenchant_Troll is offline Click Here to See the Profile for Trenchant_Troll Click here to Send Trenchant_Troll a Private Message Find more posts by Trenchant_Troll Add Trenchant_Troll to your buddy list [P] Edit/Delete Message Reply w/Quote
Large Filipino
Fuck me hard in my arse.

Registered: Feb 2004
Location: in colorado somewhere!
Posts: 47606

$%$#$%$#@!!!!

__________________

I want a Chia Obama
For Christmas

Report this post to a moderator | IP: Logged

Old Post 06-19-2013 04:42 AM
Large Filipino is offline Click Here to See the Profile for Large Filipino Click here to Send Large Filipino a Private Message Visit Large Filipino's homepage! Find more posts by Large Filipino Add Large Filipino to your buddy list [P] Edit/Delete Message Reply w/Quote
billgerat
Hope-nosis

Registered: Aug 2000
Location: ObamaNation
Posts: 25210

LF, you are.....THE FATHER to this thread!

__________________
"I'm not a firm believer in democracy," - Rand Paul -

Report this post to a moderator | IP: Logged

Old Post 06-19-2013 09:32 AM
billgerat is offline Click Here to See the Profile for billgerat Click here to Send billgerat a Private Message Find more posts by billgerat Add billgerat to your buddy list [P] Edit/Delete Message Reply w/Quote
Pinecrika
Muffer's He-beast

Registered: Jul 2001
Location: Aotearoa
Posts: 19350

Watching Maury Poopitch made me want to go on a shooting spree long before it was the "in" thing.

Go read a book LF and maybe you can regenerate some of those poor brain cells you lost watching that tripe.

__________________
"I just like holding it, sometimes I pop it in my mouth and give it a little suck, but not often." - DRZ

Report this post to a moderator | IP: Logged

Old Post 06-19-2013 09:46 AM
Pinecrika is offline Click Here to See the Profile for Pinecrika Click here to Send Pinecrika a Private Message Find more posts by Pinecrika Add Pinecrika to your buddy list [P] Edit/Delete Message Reply w/Quote
Mister Freign
Population Surplus

Registered: Aug 2006
Location: Happytown
Posts: 6433

here ya go, a free classic:

http://www.gutenberg.org/ebooks/8387

__________________
"I am like the catsup: horrible" ~ James Urbaniak

Report this post to a moderator | IP: Logged

Old Post 06-19-2013 10:28 AM
Mister Freign is online now Click Here to See the Profile for Mister Freign Click here to Send Mister Freign a Private Message Find more posts by Mister Freign Add Mister Freign to your buddy list [P] Edit/Delete Message Reply w/Quote
All times are GMT. The time now is 10:51 AM. Post New Thread    Post A Reply
  Last Thread   Next Thread
Show Printable Version | Email this Page | Subscribe to this Thread

Forum Jump:
 

Forum Rules:
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts
HTML code is ON
vB code is ON
Smilies are ON
[IMG] code is ON
 

< Contact Us - The Asylum >

Powered by: vBulletin Version 3.0.6
Copyright ©2000 - 2002, Jelsoft Enterprises Limited.
Copyright © 2000- Imaginet Inc.
[Legal Notice] | [Privacy Policy] | [Site Index]

Forums Directory